《生化2014 c16 rna transcription2.ppt》由会员分享，可在线阅读，更多相关《生化2014 c16 rna transcription2.ppt（111页珍藏版）》请在三一文库上搜索。
1、Biochemistry,Dept. of Biochemistry and Molecular Biology,Professor Wu Yaosheng 2014-06,2,Chapter 16,RNA Biosynthesis,3,Two kinds of RNA biosynthesis in organisms:,Transcription,RNA replication,3,4,Transcription-to synthesize RNA with DNA single strand as template,Introduction,1. Transcription is the
2、 first stage of the process of gene expression.,2. Transcription processes have to suffer strictly regulation to meet the need of development, morphogenesis and physiological functions of organisms .,3. The products of transcription are RNA,4,5,General picture of transcription,5,6,Main Contains, Ove
3、rview of Transcription, Transcription in Eukaryotes, Processing and degradation of Eukaryotic RNA, Transcription in Prokaryotes,6,7,Key Points, Transcription characteristics, Transcription system, RNA polymerases, Transcription initiation & stop, Postranscription modification,7,8,Section One,Templat
4、e and enzyme of prokaryotic transcription,9,Transcription,The process which RNA polymerase catalyzes the yield of RNA (tRNA, mRNA, rRNA ) with one of double strands of DNA as template, NTPs as precursors, in the light of the rule of complementary base pairing.,9,10,Precursors : NTP (ATP, UTP, GTP, C
5、TP) Template : DNA （one strand ) Enzyme: RNA polymerase, RNA-pol Other proteins (transcriptional factors et al ),The requirements of transcription,10,11,Comparison of Replication and Transcription,11,12,Only one strand of DNA molecule serves as template Asymmetric transcription No primer needed Init
6、iation at promoter site,1. General characters of transcription,12,13,DNA Transcription plot,5GCAGTACATGTC3 3c g t c a t g t a c a g5,DNA,5GCA GUA CAU GUC3,mRNA,N. Ala Val His Val .C,peptide,transcription,translation,Note：capital letters means the code strand, small letters means the template strand,
7、13,14,Some important concepts,DNA template,Template strand, antisense strand, Watson strand,Coding strand, sense strand, Crick strand,Structural gene,Asymmetric transcription,14,15,15,16,Asymmetry transcription,Structure gene,Template strand,5,3,5,3,Arrowhead means the direction of transcription,5,5
8、,5,Coding strand,16,17,For asymmetric transcription, there are two meanings:,(1) Only one strand of a gene can serve as template, the other which is complimentary to the template strand cant be transcribed.,(2) Not all the template strands of genes are found in the same strand on DNA molecule.,17,18
9、,The enzyme related to transcription is RNA polymerase, which is termed as DNA dependent RNA polymerase (DDRP) or RNA pol, or transcriptase.,2. DNA Dependent RNA Polymerase,It catalyzes the following reaction:,(NTP)n,pppN(pN)n-1 + (n-1)PPi,DNA template,RNA pol,Mg2+, Zn2+,18,19,DNA template strand,DN
10、A template strand,OH,OH,OH,OH,U,U,Transcription by RNA polymerase. In each step the incoming ribonucleotide selected is that which can base-pair with the next base of the DNA template strand.,direction,5,3,19,20,A 3-5phosphodiester bond is formed, extending the RNA chain by one nucleotide, and pyrop
11、hosphate is released. Overall the RNA molecule grows in a 53direction.,20,21,Prokaryotic RNA polymerase ( E. coli),21,22,only one RNA pol has been found: 2 (holoenzyme ) 2 ( core enzyme ),Core enzyme,Holoenzyme,RNA polymerase in prokaryotes,22,23,Holoenzyme: It can initiate transcription specificall
12、y at promoter sites and catalyze polymerization of two free NTPs. Core enzyme: It can not initiate transcription specifically at promoter sites but can catalyze RNA elongation.,Core enzyme: the RNA polymerase without the subunit is called core enzyme (2 ).,23,24,There are more than one kind of facto
13、r in prokaryotes, 70 carries out the promoter recognition process on their own, mainly responsible for the housekeeping gene expression., 32 is responsible for the heat-shock gene expression under some emergent cases.,Housekeeping genes are those that encode many proteins needed for routine cell fun
14、ctions and which are therefor expressed at low rates in all cells.,24,25,RNA polymerase binds to DNA at the Transcriptional start point,25,How many kinds of RNA polymerase have been found in prokaryotes?,26,Questions,1. The RNA polymerase that transcribe bacterial DNA is,A. multisubunit enzyme. B. m
15、onomeric and very large. C. multimeric and interchangeable. D. only active inside the cell. E. highly glycosylated in their active forms.,26,27,Questions,2. RNA chain elongation can be inhibited by,A. Repressors. B. Rifampicin (a Rifamycin derivative). C. Actinomycin D. D. RNases. E. 0.5 M NaCl.,27,
16、28,Section Two,Transcription in Prokaryotes,29,Initiation,Elongation,Termination,1. Proceeding of Transcription in Prokaryotes,29,30,1.1 Initiation of transcription,The transcriptional unit in prokaryotes is operon that consists of two regions on DNA,Operon,30,31,Regulation region,P,O,I,TTGACA,TATAA
17、TPu,Operon structure,Inhibitive protein,substrate,Structural gene region,31,32,During initiation, RNA polymerase recognizes promoter site, and then unwinds DNA locally to expose a single-stranded DNA template that can be transcribed.,Initiation of transcription,Recognition of promoter,Start of synth
18、esis,32,33,The steps of transcription initiation,(1) The sigma factor() in holoenzyme of RNA pol recognizes the promoter and let the whole enzyme to bind with the promoter sequence.,(2) To unwind the local region of promoter on DNA and to form a transcription initiation bubble .,(3) To form a initia
19、tion complex of transcription.,Holoenzyme- DNA-pppGpN-OH,33,34,34,35,Transcriptional start site,Transcriptional bubble,pppG-OH + pppN-OH pppGpN-OH + PPi,Holoenzyme of RNA pol,35,36,TATAAT,-10,RNA pol,36,37,-10 sequence: Located about 10 nucleotides upstream of where transcription will begin. -35 seq
20、uence: Located about 35 nucleotides upstream.,TTGACA,TATAAT,-35,-10,Transcriptional start site,5,By convention, the first nucleotide of the template DNA that is transcribed into RNA is denoted +1, the transcriptional start site.,+1,Two important sequence in prokaryotic promoters:,?,37,38,Consensus s
21、equence of promoter in E. coli,Pribnow box,Promoter,38,39,1.2 Elongation of transcription,The elongation phase of RNA synthesis, which begins after formation of the first bond, is carried out by core enzyme.,The transcriptional complex:,Core enzyme of RNA pol-DNA template-new RNA,39,40,Core enzyme(2
22、) moves along the gene, synthesizes a complementary RNA copy to the DNA template, using four ribonucleoside 5 triphosphates (ATP,CTP,GTP,UTP) as precursors.,-subunit dissociates from the enzyme, once transcription has been initiated .,3-OH at the end of the growing RNA chain attacks the phosphate gr
23、oups of the incoming ribonucleoside 5 triphosphate to form a 35 phosphodiester bond.,40,41,The complex of RNA polymerase, DNA template and new RNA transcript is called a transcription bubble. Because within it there is a region where the DNA double helix has opened up to allow transcription to occur
24、.,The RNA transcript forms a transient RNA-DNA hybrid helix with its template strand but then peels away from the DNA as transcription proceeds.,Transcription bubble,41,42,transcription bubble,RNA-pol （core enzyme） DNA RNA,42,43,Direction : RNA is synthesized in the 53direction. DNA template is read
25、 in the 3 5 direction.,The DNA is unwound ahead of the transcription bubble, and after the transcription complex has passed , the DNA rewind.,43,44,DNA template strand,DNA template strand,OH,OH,OH,OH,U,U,Overall the RNA molecule grows in a 53direction.,direction,5,3,44,45,1.3 Termination of transcri
26、ption in prokaryotes,There are two forms in termination,(2) Rho () factor independent termination,(1) Rho () factor dependent termination,45,46,Those that lack such a structure require an additional protein, called rho (), to allow recognition of the termination site and stop transcription.,Rho (),
27、can bind to the 3 end of RNA and to change the conformation of RNA pol, therefore to loose the binding RNA pol with DNA template, then release out from the bubble.,(1) Rho () factor dependent termination,46,47,Mechanism of factor action,47,48,48,49,The simplest termination signal is a GC-rich region
28、 in the template that is a palindrome, followed by an AT-rich sequence. The RNA made from the DNA palindrome is self-complementary and so base-pairs internally to form a hairpin structure followed by a few U residues.,(2) Rho () factor independent termination,49,50,5-GCCGCCAGUUCGGCUGGCGGC-AUUUU-OH 3
29、,Transcription,A typical hairpin structure formed by the 3 end of an RNA molecule during termination of transcription.,template,RNA,50,51,5UUGCAGCCUGACAAAUCAGGCUGAUGGCUGGUGACUUUUUAGUCACCAGCCUUUUU. 3,5UUGCAGCCUGACAAAUCAGGCUGAUGGCUGGUGACUUUUUAGUCACCAGCCUUUUU. 3,RNA,5TTGCAGCCTGACAAATCAGGCTGATGGCTGGTGAC
30、TTTTTAGTCACCAGCCTTTTT. 3,DNA,5UUGCAGCCUGACAAAUCAGGCUGAUGGCUGGUGACUUUUUAGUCACCAGCCUUUUU. 3,Its a universal phenomena to terminate transcription by the formation of hairpin near terminal region and rho independent.,51,52,rho () factor independent model,The hairpin structure alters RNA pol conformation
31、, transcription stop;,Transcription complex is divided and RNA is released,52,53,53,54,2. Processing of Post Transcription in Prokaryotes,In prokaryotes, mRNA requires little or no modification prior to translation.,rRNA:,(1) Cleavage: the rRNA precursor molecule is cleaved by specific ribonucleases
32、 to yield mature 23s,16s and 5s rRNA. (2) Methylation of some bases and ribose moieties of rRNA also occurs.,mRNA:,54,55,5,3,DNA,Ribosome,RNA,RNA pol,55,56,Questions,Why does the transcription coupled with translation in prokaryotes?,How to stop the transcription in prokaryotes?,56,57,Questions,1. D
33、uring transcription initiation the template DNA strands are separated (“melted“) from about positions,A. -35 to +1 after chain initiation. B. -9 to +2 after chain initiation. C. -35 to +1 prior to chain initiation. D. -9 to +2 prior to chain initiation. E. -1 to +1 during ATP or GTP binding.,57,58,Q
34、uestions,2. An operon is a transcriptional unit in bacteria that contains,A. a promoter site, an operator site, and one or more regulatory genes. B. a promoter site, an operator site, and two or more structural genes. C. cis-acting elements adjacent to trans-acting factors. D. RNA polymerase loading
35、 zones. E. The 2nd and 3rd choices are both correct.,58,59,Section Three,Transcription in Eukaryotes,60,The different eukaryotic RNA polymerase could transcribe different type of genes Promotor structure is more complex RNA pol couldnt directly bind to a promotor, a few of TFs are needed Transcripti
36、on occur in cell necleus, but translation occur in cytoplasm Transcription termination is associated with post-transcription modification,60,Features of transcrion in eukaryotes,61,Eukaryotic RNA polymerase,Amanitin，鹅膏蕈碱,61,1. DNA dependent RNA polymerase in eukaryotes,62,RNA polymerase II is respon
37、sible for biosynthesis of mRNA in eukaryotes,It contains 12 subunits:,The largest one contains carboxyl-terminal domain, CTD,RNA pol II,62,RNA polymerase II,CTD: YSPTSPS,63,Transcription factors and promoters,RNA pol, promoter, TFs, precursors (NTP),63,2. Transcriptional factors in Eukaryotes,64,Cla
38、ss and functions of TF II,64,65,(A point for cutting and adding a tail ),Structures of gene in eukaryotes:,Promoter, cis-action elements, exon, intron,65,66,Genes in eukaryotes are split gene (断裂基因）,A gene consists of exons and introns.,Class two of promoter,TF II,Promoter structure:,RNA pol II,66,B
39、RE (TF II B recognition element ); Inr (initiator),67,1.1 Initiation of mRNA Synthesis,To form pre-transcription initiation complex(PIC),First, a closed complex (闭合复合物），Secondly, an open complex ( 开放复合物）, To join two nucleotides to form pppGpN-OH with first phosphodiester bond, To form a transcripti
40、on bubble (转录泡)-transcription initiation complex,67,68,The forming of transcription initiation complex,(1) TFIID binds to the TATA box. The key subunit of TF II D is TBP(TATA box-binding protein). (2) TFII A binds, followed by TF II B. (3) RNA polymerase II, which has already complex with TFIIF,bind
41、s followed by the binding of TFIIE,H. (4) The transcription begins when forming of transcription initiation complex. (5) It is a basal transcription apparatus. Transcription is only at a low rate. For a high rate of transcription, other transcription factors are required.,68,69,TF II D,D,TFIIA, TFII
42、B, TFIIF, RNA polymerase II,D,B,TFIIE, TFIIH, TFIIJ,Transcription starts,Initiation of transcription by RNA polymerase II. TFIID binds to the TATA box followed in order by the binding of TFIIA,TFIIB and a pre-formed complex of TFIIF-RNA polymerase II. Subsequently TFIIE, TFIIH bind in order and tran
43、scription then starts about 25 bp downstream from the TATA box.,Pol II,F,Note that the placement of the the various factors in this diagram is arbitrary; their exact position in the complex are not yet known.,PIC formation in order:,TFIIDA B F pol II E H,D,B,Pol II,F,69,70,70,71,1.2 Elongation of mR
44、NA transcription,Elongation When the transcription initiation complex is formed, the transcription begins and the elongation of the RNA chain continues until termination occurs.,71,72,1.3 Termination of mRNA transcription,Unlike RNA polymerase in prokaryotes, RNA polymerase II does not terminate tra
45、nscription at specific sites but rather transcription stops at varying distances downstream of the gene.,Termination site,Modification signal,Adding of poly A tail,Cleavage site,72,73,Transcription termintation and adding of tail at 3-end in eukaryotes,73,74,Questions,What are requirements for mRNA
46、biosynthesis in eukaryotes ?,Specially for initiation stage?,74,75,Questions,2. A promoter is,A. a manager for a sports team. B. a specific sequence of DNA to which RNA polymerase binds. C. a specific sequence of DNA to which a catabolic repressor binds. D. a specific DNA sequence to which a restric
47、tion endonuclease binds. E. not found in eukaryotic cells.,75,76,Questions,3. When subunit dissociates from an initiated RNA polymerase,A. it can bind a core enzyme to reform holoenzyme. B. it leaves behind an elongating species complexed with Rho factor. C. it hydrolyzes ATP until rebound by core e
48、nzyme. D. it remains bound to the promoter consensus sequence. E. None of the above are correct.,76,77,Section Four,Processing & Degradation of Eukaryotic RNA,78,Including:,1. Processing of Eukaryotic mRNA,Capping of mRNA at 5-end, Alternative pre-mRNA splicing, Adding of poly A tail at 3-end ( polyadenylation ), Removal of introns from mRNA precursor, mRNA editing,78,79,5cap added 3poly(A) added,promoter,termination region,Exon 1,Exon 2,Exon 3,Intron1,Intron2,Primary RNA transcript (hnRNA),Cleavage by endonuclease and addition of poly(a) tail,poly(a) tai